Séquençage SANGER

Horaire

Nous offrons le service de séquençage du lundi au vendredi, et les résultats sont disponibles dans les prochaines 48 heures ouvrables. Pour les projets à très haut débit, appelez-nous pour discuter d’un échéancier.

Horaire de séquençage automatique

Réception avant 16 h 15 leSéquences remises le
LundiMercredi
MardiJeudi
MercrediVendredi
JeudiLundi
VendrediMardi
* Veuillez prendre note que nous ne recevons pas d’échantillons les jours fériés; les dates de remise seront également retardées du nombre de jours de la durée des fériés.

Techniques

Quelle que soit la nature des matrices d’ADN, leur séquence est déterminée par électrophorèse capillaire grâce à une réaction de polymérisation avec la chimie des Big Dye 3.1 sur des thermocycleurs à 96 ou 384 puits. Tous les échantillons sont résolus sur une des plateformes d’Applied Biosystems, le ABI 3730xl. Cet appareil de 96 capillaires met à profit l’électrophorèse, la fluorescence et l’optique afin de résoudre simultanément la séquence de 96 échantillons sur plus de 800 nucléotides. L’appareil, entièrement robotisé, peut résoudre plus de 1 000 échantillons quotidiennement, pour un total de un million de nucléotides. Notre expérience nous a permis d’acquérir une flexibilité qui répond à la fois aux projets de quelques séquences et à ceux de plusieurs milliers, de façon à satisfaire les différents besoins des chercheurs. Nos délais de traitement sont actuellement de 48 heures.

Ouverture de compte

Afin de pouvoir soumettre des échantillons, vous devez d’abord ouvrir un compte utilisateur. Pour ce faire, communiquez par courriel avec le responsable de la plateforme, Patrick Laplante, en incluant les informations suivantes :

  • Le nom de votre chercheur ou équipe;
  • Un mot de passe alphanumérique de 8 caractères et commençant par une lettre;
  • Le numéro de téléphone pour vous rejoindre ainsi que le poste;
  • Une adresse courriel.

Si votre chercheur ou équipe n’est pas déjà inscrit, il vous faudra également ouvrir un compte pour celui-ci. Les informations suivantes seront alors requises :

  • Le nom et le prénom du chercheur ou le nom de l’équipe;
  • Votre département;
  • Votre adresse;
  • Le numéro de téléphone;
  • La méthode de paiement que vous utiliserez:
    • Carte de crédit
    • Bon de commande
    • Numéro de budget CHU

Votre nom d’utilisateur vous sera par la suite envoyé par courriel.

Préparation des ADN

Plus la préparation de votre ADN sera de bonne qualité, plus les chances d’obtenir une bonne longueur de lecture seront élevées.

Si votre ADN est GC-riche, qu’il s’agit de shRNA ou encore qu’il s’agit d’ADN bisulfité, mentionnez-le-nous dans la section Instruction Spéciale du formulaire de commande. Les structures secondaires qu’ils contiennent peuvent altérer la qualité de la séquence. Nous utilisons donc des protocoles alternatifs.

  • Plasmide
    • Concentration: 50 ng/µl dans du Tris 10 mM pH 8,0 ou H2O.
      Il est important de bien mesurer la concentration de vos ADN. Trop concentrée, la réaction de séquence pourrait chuter rapidement et diminuer grandement la longueur de lecture. Inversement, une trop faible concentration d’ADN produirait un bruit de fond élevé et induirait des erreurs dans la détermination de votre séquence.Attention lors de la resuspension de vos ADN car l’EDTA inhibe l’enzyme de séquençage en chélatant ses cofacteurs.
    • DO 260/280 : entre 1,8 et 2,0 et DO 260/230 : entre 2,0 et 2,2.
      Ceux-ci sont de bons indicateurs de la pureté de votre ADN. S’il reste de l’ARN, du solvant, des sels ou des protéines dans votre échantillon, la qualité de la séquence en sera affectée.
    • Volume: 15 µl/reaction.
      Nous demandons 10 µl par réaction de séquençage et un 5 µl de surplus. Si vous ne pouvez pas nous fournir le volume demandé, nous ne pourrons faire qu’une seule réaction de séquence sans possibilité de reprise ou de vérification de dosage au Nanodrop 2000c.
    • Purification: colonnes de type commercial.
      Il est recommandé d’utiliser une trousse de purification commerciale afin d’obtenir des ADN de bonne qualité. Plus vos ADN seront bien préparés, plus la séquence sera de bonne qualité.Attention aux extractions de type lyse alcaline: il reste souvent des contaminants qui inhibent la réaction de séquence. Si vous faites une purification phénol/chloroforme, prenez soin de ne pas récupérer ces solvants organiques.Peu importe le type de purification que vous utiliserez, celle-ci ne doit pas laisser de trace de solvant, ou des quantités élevées de sels, de protéines ou d’ARN qui inhiberont la réaction de séquence, c’est pourquoi nous vous conseillons fortement un deuxième lavage lors des purifications de style miniprep ainsi qu’une centrifugation à vide avant l’élution pour éliminer toute trace de contaminants sur la colonne.
  • PCR
    Nous diluons vos produits PCR selon la longueur de paire de base de ceux-ci. Il est important d’être précis sur cette information afin d’obtenir la bonne concentration de départ avant la réaction de séquençage. Lorsque vous remplissez le formulaire de commande, arrondissez le nombre de paire de base au nombre supérieur près.

    • Concentration: 5 ng/µl et plus.
      Ne pas diluer vos produits PCR. Une PCR de bonne efficacité vous donnera facilement plus de 5 ng/µl. Si vous n’arrivez pas à de tels rendements, il est possible que la réaction de séquence en soit affectée également.
    • Volume: 20 à 50 µl/reaction. (maximum de 50 µl/tube pour les PCR à purifier)
      Si vous ne pouvez pas nous fournir le volume demandé, nous ne pourrons faire qu’une seule réaction de séquençage, sans possibilité de reprise.
    • Purification: colonnes de type commercial.
      Il est important de bien purifier le produit de PCR obtenu. S’il reste des traces d’oligos utilisés pour l’amplification, vous obtiendrez une double séquence. Également, s’il reste des dNTP ou des sels, les concentrations de la trousse de séquençage seront altérées et cela diminuera le rendement de la réaction de séquençage.Il est également primordial de n’avoir qu’un seul produit d’amplification par PCR. Sinon, il vous faudra les séparer sur gel d’agarose avant de nous faire parvenir votre échantillon. Cependant, pour une raison que nous ne pouvons pas expliquer, les fragments ainsi purifiés ne donnent pas toujours de bons résultats de séquençage. Alors il serait peut-être préférable de retravailler vos conditions de PCR afin d’en arriver à un seul produit.Nous offrons sans frais supplémentaires la purification des échantillons de PCR sur membrane de fibre de verre afin d’éliminer les oligos, les dNTP et les sels. Il est important d’avoir un amplicon unique de plus de 150 nucléotides.

Amorces

  • Amorces spécifiques
    • concentration : 1,6 uM ( environ 15 à 20 ng/µl)
    • volume : 5 µl/réaction
    • spécifications :
      Nous avons besoin d’une amorce par réaction de séquençage qui s’apparente à celles utilisées pour le PCR. Par exemple, un 18 à 24 mers avec un contenu en GC de plus de 50% est adéquat.Votre amorce doit également être spécifique à votre matrice d’ADN afin d’éviter les doubles séquences.Attention aux erreurs en 3 prime de l’amorce: elles rendent la réaction de séquence impossible.

      Évitez les structures secondaires dans vos amorces, le rendement de la réaction de séquence en sera affecté.

  • Amorces universelles

    Banque d’amorces disponibles gratuitement

    NomSéquenceTm (ºC)
    SP6TATTTAGGTGACACTATAG42
    T3PCGAAATTAACCCTCACTAAAGG51
    T5-FAATTTATTTGCTTTGTGAGC47
    T5PCCCGAAAAGTGCCACCTG57
    T7-EEVAAGGCTAGAGTACTTAATACGA50
    T7pTAATACGACTCACTATAGG45
    T7tGCTAGTTATTGCTCAGCGG53
    BGHTAGAAGGCACAGTCGAGG54
    M13F-20GTAAAACGACGGCCAGT53
    M13F-47CGCCAGGGTTTTCCCAGTCACGAC64
    M13R-17CAGGAAACAGCTATGAC47
    M13R-20GCGGATAACAATTTCACACAGG55
    M13R-48AGCGGATAACAATTTCACACAGGA57
    3-ADAGATGGTGCACGATGCACAG58
    3-DNABDTTTTCGTTTTAAAACCTAAGAGTC49
    Ac5ACACAAAGCCGCTCCATCAG58
    Attr2_revAGGTTCCTTCACAAAGATCC52
    5-AOX1GACTGGTTCCAATTGACAAGC 54
    3-AOX1GCAAATGGCATTCTGACATCC55
    CYC1GCGTGAATGTAAGCGTGAC54
    CAG-FTCGGCTTCTGGCGTGTGACC63
    CAG-RTGTCCCCATAATTTTTGGCAGAGG58
    C-CMV-24TATTAGGACAAGGCTGGTGGGCAC61
    CMV-ForwardCGCAAATGGGCGGTAGGCGTG64
    N-CMV-30AATGTCGTAATAACCCCGCCCCGTTGACGC67
    DsRed1-CAGCTGGACATCACCTCCCACAACG63
    EXFP-RGTCTTGTAGTTGCCGTCGTC56
    EBVrevGTGGTTTGTCCAAACTCATC52
    EF1a_fwdTCAAGCCTCAGACAGTGGTTC57
    EGFPC2_fwdCCCAACGAGAAGCGCGATC59
    EGFPC2_revCACTCAACCCTATCTCGGTC55
    EGFP-CforAGCACCCAGTCCGCCCTGAGC67
    EGFP-NrevCGTCGCCGTCCAGCTC59
    GFP-CforGGTCCTTCTTGAGTTTGTAAC51
    GFP-FwGAAGCAGCACGACTTCTTC54
    GFP-reverseGGGTAAGCTTTCCGTATGTAGC55
    pEGFP-CCCTGCGGAGTTCG49
    pEGFP-C-3TATGGCTGATTATGATCAGT48
    pEGFP-C-5CATGGTCCTGCTGGAGTTCGTG60
    pEGFP-N-3CGTCGCCGTCCAGCTCGACCAG66
    pEGFP-N-5TGGGAGGTCTATATAAGCAGAG53
    GLprimer2CTTTATGTTTTTGGCGTCTTCCA54
    GLprimer4GGGTAGAATGGCGCTGGG68
    RVprimer3CTAGCAAAATAGGCTGTCCC53
    RVprimer4GACGATAGTCATGCCCCGCG61
    H1FTGTTCTGGGAAATCACCATA51
    HA-reverseGCGTAGTCTGGGACGTCGTATGGGTA63
    hEF1aprom-FAACTGGGAAAGTGATGTCGTG55
    hGata4-revATTGTGGATGAATACTGCC50
    hGH-pA-RCCAGCTTGGTTCCCAATAGA54
    hU6-FGAGGGCCTATTTCCCATGATT54
    IRES-FTGGCTCTCCTCAAGCGTATT56
    IRES-RCCTCACATTGCCAAAAGACG55
    Lambda-t0GGTCATTACTGGAGTCTTG50
    LKO1-5GACTATCATATGCTTACCGT50
    LucNrevCCTTATGCAGTTGCTCTCC47
    Luc-FAGTCAAGTAACAACCGCGA54
    Rluc-RevTCGCTGTCGTAGTAGTTGATGA55
    MT_ForwardCATCTCAGTGCAACTAAA47
    mCherry-FCCCCGTAATGCAGAAGAAGA55
    mCherry-RTTGGTCACCTTCAGCTTGG55
    mCherry-CTerCCCACAACGAGGACTACA54
    Neo-FCGTTGGCTACCCGTGATATT55
    Neo-RGCCCAGTCATAGCCGAATAG55
    pASK-fwdGAGTTATTTTACCACTCCCT49
    pASK-revCGCAGTAGCGGTAAACG54
    pBR322ori-FGGGAAACGCCTGGTATCTTT55
    pCasper-hsGCAACTACTGAAATCTGCCAAG54
    pcDNA3-4-REVCAACATAGTTAAGAATACCAGTC49
    pENTR-FCTACAAACTCTTCCTGTTAGTTAG51
    pENTR-RATGGCTCATAACACCCCTTG55
    pGEXfwGGCAAGCCACGTTTGGTG58
    pGEXrvGAGCTGCATGTGTCAGAGG56
    pGEXfw-longGGGCTGGCAAGCCACGTTTGGTG66
    pGEXrv-longCCGGGAGCTGCATGTGTCAGAGG64
    pGK-forwardCATTCTGCACGCTTCAAAAG53
    pJETFCGACTCACTATAGGGAGAGCGGC61
    pJETRAAGAACATCGATTTTCCATGGCAG56
    pLightSwitch-FTCCATCAAAACAAAACGAAACAA52
    pLightSwitch-RAGTCGAGCACGTTCATCTGCTT59
    pMSCVGAGACGTGCTACTTCCATTTGTC56
    pMSCV-5'CCCTTGAACCTCCTCGTTCGACC61
    PolyhedrinAAATGATAACCATCTCGC47
    Poly-TTTTTTTTTTTTTTTTTTTTTTTTT(A/C/G)42
    PQE-RevGTTCTGAGGTCATTACTGG50
    RSV-fwdCATGCCGATTGGTGGAAGTAAG56
    S-tagGAACGCCAGCACATGGACA58
    SV40pA-RGAAATTTGTGATGCTATTGC48
    SV40pro-FTATTTATGCAGAGGCCGAGG54
    SV40revGGTATGGCTGATTATGATC47
    SV40-pA-JHAAAAAACCTCCCACACCTCC55
    Tet-pLKO-neo-FGGCAGGGATATTCACCATTATCGTTTCAGA60
    TypeIII-IVCGGATAACAATTTCACACAG49
    V5_C-termACCGAGGAGAGGGTTAGGGAT59
    WDR36exon18-FGATGGCATCTATGACATAAGTC51
    WDR36exon19-RGCATTGTCAGTGCTGTCTTAC54
    WPRE-RCATAGCGTAAAAGGAGCAACA53
    16S-27FAGAGTTTGATCCTGGCTCAG54
    16S-27F(M)AGAGTTTGATCMTGGCTCAG54
    16S-534RATTACCGCGGCTGCTGG59
    18S-NS1GTAGTCATATGCTTGTCTC47
    18S-NS4CTTCCGTCAATTCCTTTAAG49
    18S-NS8TCCGCAGGTTCACCTACGGA61
    ITS1TCCGTAGGTGAACCTGCGG60
    ITS4TCCTCCGCTTATTGATATGC52
    * Si votre amorce universelle n’est pas dans cette liste, il nous fera plaisir de la faire synthétiser et de l’y ajouter.

Règles d’envoi

  • Tous les échantillons doivent nous parvenir dans des microtubes de 1,5 ml (style Eppendorf), dans des tubes à PCR en « strip » ou dans des microplaques de 96 puits. Lorsque vous avez plusieurs échantillons (24 ou plus), il est plus facile pour nous de manipuler des plaques ou des strips. De plus, vous aurez moins d’identification à faire et cela réduit les erreurs de manipulations.
  • Toujours écrire votre numéro de commande sur le dessus de vos tubes; il vous sera fourni sur la page de confirmation de commande.
  • Inscrivez lisiblement vos noms d’échantillons et d’amorces sur le côté de vos tubes. Si les noms de vos échantillons sont très longs, vous pouvez aussi identifier vos tubes avec le numéro de puits correspondants à celui du formulaire de commande. (ex: 1, 2, 3,… ou A1-B1, C1-D1, …)
  • Si vous vous servez de parafilm pour fermer vos tubes, utilisez la quantité minimale.
  • Chaque tube doit avoir au minimum 10 µl.
  • N’utilisez pas de ruban gommé pour identifier vos tubes, il a la fâcheuse habitude de décoller à -20 ºC.
  • N’utilisez pas de ruban gommé pour lier vos échantillons ensemble, il est difficile de les séparer et efface l’encre sur les tubes. Utilisez plutôt une enveloppe, un sac d’emballage (ex: Ziploc®) ou tout autre contenant facile à manipuler.
  • Il n’est pas nécessaire de mettre vos ADN sur glace ou sur glace sèche s’ils ne sont pas contaminés par des endonucléases.
  • Il est recommandé de protéger vos échantillons lors du transport par courrier ou par service de messagerie : enveloppe avec du papier bulle ou dans un contenant solide comme un tube Falcon vissée de 50 mL.

Attention : assurez-vous que vos échantillons ne nous arriveront pas pendant la fin de semaine ou une journée fériée.

Adresse d’envoi

  • Pour l’externe :Patrick Laplante,
    Responsable
    Plateforme de séquençage et de génotypage (CRCHU de Québec-CHUL)
    2705, boulevard Laurier, TR-72
    Québec, Québec
    CANADA G1V 4G2
  • Pour l’interne :
    • vos échantillons peuvent être laissés à la réception du bloc T au local TR-72 ou à l’entrée du Centre de recherche en infectiologie au local RC-709;
    • vous pouvez venir nous les porter au local R-4756 si vous y avez accès;
    • vous pouvez nous les envoyer par le courrier interne; comptez cependant une journée supplémentaire.