SANGER Sequencing

Time Frame

We provide sequencing service from Monday to Friday. Results are available within 48 working hours. For high throughput, please contact us so that we may discuss the time required.

Automatic Sequencing Time Frame

Reception before 4:15 p.m.Séquences remises le
MondayWednesday
TuesdayThursday
WednesdayFriday
ThursdayMonday
FridayTuesday
* Please note that we cannot receive samples on holidays, and that delivery rates will be delayed according to the holiday length.

Techniques

The platform use the Sanger technique to perform the sequencing. A polymerase chain reaction (PCR) is first conducted using Big Dye 3.1 terminators and thermocyclers in either 96 or 384 reaction-well microplate format. The sequence is then determined by capillary electrophoresis. All the samples are analyzed using one of Applied Biosystems platform, the ABI 3730xl Data Analyzer. This 96-capillary sequencer applies electrophoresis, fluorescence, and optical techniques to simultaneously analyze the sequence of 96 samples for more than 800 nucleotides. The ABI 3730xl can attains a capacity of more than 1,000 samples per day for a total of one million nucleotides. Through years of work with our numerous researchers, we have developed the experience and flexibility needed to carry out projects comprising of a few to several thousand sequences. It currently takes us 48 hours to analyze projects.

Open an account

To submit samples, you have to open a user account first. To do so, please contact by e-mail the lab manager, Patrick Laplante, and include the following information:

  • The name of your researcher or your team;
  • A password with 8 alphanumeric characters, starting by a letter;
  • A phone number where you can be reached with the extension;
  • An e-mail adress.

If your researcher or your team aren’t yet registered, an account will be necessary for them as well. The following information will be required:

  • The first name and the last name of your researcher or the name of your team;
  • Your department;
  • Your address;
  • The phone number where you can be reached;
  • The payment method you want to use:
    • Credit Card
    • Purchase order
    • CHU budget number

Your user name will be sent to you by e-mail.

DNA Preparation

Please note that the better the quality of your DNA preparation are, the greater your chances of obtaining a good read length.

If you have a DNA with a high GC-content, a shRNA or a bisulfite DNA, please indicate it in the section Instruction Spéciale of the request form as well. GC-rich DNA sequences require distinct treatments to obtain a good sequence.

  • Plasmid
    • Concentration: 50 ng/µl in Tris 10 mM pH 8,0 or H2O
      It is essential to correctly measure the concentration of your DNA. If the DNA is too concentrated, the sequencing reaction could drop off quickly and greatly diminish your read length. Conversely, an overly weak DNA concentration will produce excess background noise and introduce errors into the sequence analysis.
      It is best to avoid using EDTA when resuspending your DNA for the reason that EDTA inhibits the sequencing enzyme by chelating its co-factors
    • Volume: 15 µl/reaction
      We ask for 10 µl per reaction for the sequencing and a 5 µl extra. If you provided less volume than that, then we will only be able to do one sequencing reaction without any possibility of resequencing or quantify on the Nanodrop 2000c.
    • DO 260/280 : between 1,8 and 2,0 et DO 260/230 : between 2,0 and 2,2
      These are good indicators of your DNA purity. RNA, solvents, salts and proteins could affect the quality of the sequencing.
    • Purification: Commercial columns
      We recommend using commercial purification kits to obtain quality DNA. The quality of DNA preparation directly affects sequencing results.
      Alkaline lysis extractions often leave contaminants that inhibit the sequencing reaction. When conducting a phenol/chloroform purification, be careful not to recuperate these organic solvents.
      Whatever method of purification is used, alleviate any traces of solvents, high quantities of salts, proteins, or RNA that will inhibit the sequencing reaction.
  • PCR
    • Concentration: 5 ng/µl or more
      Do not dilute your PCR products. If the concentration of your samples is less than 5 ng/µl, then it is likely that the sequencing reaction will be affected.
    • Volume: 20 to 50 µl/reaction. (50 µl/tube maximum for the PCR product non-purified)
      Please provide at least 20 µl of each DNA sample. If you provided less than that, we will be limited in the number of sequence reaction we can do.
    • Purification: Commercial columns
      It is important that PCR products are well-purified. If any traces of the oligos used to amplify the DNA remain, it will result in a double sequence. Likewise, if there are any dNTPs or salts remaining, the concentrations in the sequencing kit will be altered producing unfavorable results from the sequencing reaction.
      It is equally essential that you only obtain one amplification product per PCR. Otherwise, you will have to separate them on an agarose gel before sending us your samples. However, agarose gel purification yields lesser sequencing results. Therefore, it would be preferable that you might adjust your PCR conditions to yield one amplicon per PCR.
      We provide, free of charge, PCR sample purification on fiber glass in order to eliminate oligos, dNTPs and salts. It is important to ensure that each amplicon length is more than 150 nucleotides.

Primers

  • Specific primers
    • concentration: 1,6 µM (~15-20 ng/µl)
    • volume: 5 µl/reaction
    • specifications :
      For each sequencing reaction, we require that the primer length is between 18 and 24 bases with a GC content of more than 50%.
      Your primer must be specific to your DNA templates in order to avoid double sequencing.
      Please avoid errors at the 3-prime end of the oligos, as they make the sequencing reaction impossible.
      Likewise, please avoid secondary structures in the primer: the sequencing reaction will be affected.
  • Universal primers

    Bank of free primers

    NameSequenceTm (ºC)
    SP6TATTTAGGTGACACTATAG42
    T3PCGAAATTAACCCTCACTAAAGG51
    T5-FAATTTATTTGCTTTGTGAGC47
    T5PCCCGAAAAGTGCCACCTG57
    T7-EEVAAGGCTAGAGTACTTAATACGA50
    T7pTAATACGACTCACTATAGG45
    T7tGCTAGTTATTGCTCAGCGG53
    BGHTAGAAGGCACAGTCGAGG54
    M13F-20GTAAAACGACGGCCAGT53
    M13F-47CGCCAGGGTTTTCCCAGTCACGAC64
    M13R-17CAGGAAACAGCTATGAC47
    M13R-20GCGGATAACAATTTCACACAGG55
    M13R-48AGCGGATAACAATTTCACACAGGA57
    3-ADAGATGGTGCACGATGCACAG58
    3-DNABDTTTTCGTTTTAAAACCTAAGAGTC49
    Ac5ACACAAAGCCGCTCCATCAG58
    Attr2_revAGGTTCCTTCACAAAGATCC52
    5-AOX1GACTGGTTCCAATTGACAAGC 54
    3-AOX1GCAAATGGCATTCTGACATCC55
    CYC1GCGTGAATGTAAGCGTGAC54
    CAG-FTCGGCTTCTGGCGTGTGACC63
    CAG-RTGTCCCCATAATTTTTGGCAGAGG58
    C-CMV-24TATTAGGACAAGGCTGGTGGGCAC61
    CMV-ForwardCGCAAATGGGCGGTAGGCGTG64
    N-CMV-30AATGTCGTAATAACCCCGCCCCGTTGACGC67
    DsRed1-CAGCTGGACATCACCTCCCACAACG63
    EXFP-RGTCTTGTAGTTGCCGTCGTC56
    EBVrevGTGGTTTGTCCAAACTCATC52
    EF1a_fwdTCAAGCCTCAGACAGTGGTTC57
    EGFPC2_fwdCCCAACGAGAAGCGCGATC59
    EGFPC2_revCACTCAACCCTATCTCGGTC55
    EGFP-CforAGCACCCAGTCCGCCCTGAGC67
    EGFP-NrevCGTCGCCGTCCAGCTC59
    GFP-CforGGTCCTTCTTGAGTTTGTAAC51
    GFP-FwGAAGCAGCACGACTTCTTC54
    GFP-reverseGGGTAAGCTTTCCGTATGTAGC55
    pEGFP-CCCTGCGGAGTTCG49
    pEGFP-C-3TATGGCTGATTATGATCAGT48
    pEGFP-C-5CATGGTCCTGCTGGAGTTCGTG60
    pEGFP-N-3CGTCGCCGTCCAGCTCGACCAG66
    pEGFP-N-5TGGGAGGTCTATATAAGCAGAG53
    GLprimer2CTTTATGTTTTTGGCGTCTTCCA54
    GLprimer4GGGTAGAATGGCGCTGGG68
    RVprimer3CTAGCAAAATAGGCTGTCCC53
    RVprimer4GACGATAGTCATGCCCCGCG61
    H1FTGTTCTGGGAAATCACCATA51
    HA-reverseGCGTAGTCTGGGACGTCGTATGGGTA63
    hEF1aprom-FAACTGGGAAAGTGATGTCGTG55
    hGata4-revATTGTGGATGAATACTGCC50
    hGH-pA-RCCAGCTTGGTTCCCAATAGA54
    hU6-FGAGGGCCTATTTCCCATGATT54
    IRES-FTGGCTCTCCTCAAGCGTATT56
    IRES-RCCTCACATTGCCAAAAGACG55
    Lambda-t0GGTCATTACTGGAGTCTTG50
    LKO1-5GACTATCATATGCTTACCGT50
    LucNrevCCTTATGCAGTTGCTCTCC47
    Luc-FAGTCAAGTAACAACCGCGA54
    Rluc-RevTCGCTGTCGTAGTAGTTGATGA55
    MT_ForwardCATCTCAGTGCAACTAAA47
    mCherry-FCCCCGTAATGCAGAAGAAGA55
    mCherry-RTTGGTCACCTTCAGCTTGG55
    mCherry-CTerCCCACAACGAGGACTACA54
    Neo-FCGTTGGCTACCCGTGATATT55
    Neo-RGCCCAGTCATAGCCGAATAG55
    pASK-fwdGAGTTATTTTACCACTCCCT49
    pASK-revCGCAGTAGCGGTAAACG54
    pBR322ori-FGGGAAACGCCTGGTATCTTT55
    pCasper-hsGCAACTACTGAAATCTGCCAAG54
    pcDNA3-4-REVCAACATAGTTAAGAATACCAGTC49
    pENTR-FCTACAAACTCTTCCTGTTAGTTAG51
    pENTR-RATGGCTCATAACACCCCTTG55
    pGEXfwGGCAAGCCACGTTTGGTG58
    pGEXrvGAGCTGCATGTGTCAGAGG56
    pGEXfw-longGGGCTGGCAAGCCACGTTTGGTG66
    pGEXrv-longCCGGGAGCTGCATGTGTCAGAGG64
    pGK-forwardCATTCTGCACGCTTCAAAAG53
    pJETFCGACTCACTATAGGGAGAGCGGC61
    pJETRAAGAACATCGATTTTCCATGGCAG56
    pLightSwitch-FTCCATCAAAACAAAACGAAACAA52
    pLightSwitch-RAGTCGAGCACGTTCATCTGCTT59
    pMSCVGAGACGTGCTACTTCCATTTGTC56
    pMSCV-5'CCCTTGAACCTCCTCGTTCGACC61
    PolyhedrinAAATGATAACCATCTCGC47
    Poly-TTTTTTTTTTTTTTTTTTTTTTTTT(A/C/G)42
    PQE-RevGTTCTGAGGTCATTACTGG50
    RSV-fwdCATGCCGATTGGTGGAAGTAAG56
    S-tagGAACGCCAGCACATGGACA58
    SV40pA-RGAAATTTGTGATGCTATTGC48
    SV40pro-FTATTTATGCAGAGGCCGAGG54
    SV40revGGTATGGCTGATTATGATC47
    SV40-pA-JHAAAAAACCTCCCACACCTCC55
    Tet-pLKO-neo-FGGCAGGGATATTCACCATTATCGTTTCAGA60
    TypeIII-IVCGGATAACAATTTCACACAG49
    V5_C-termACCGAGGAGAGGGTTAGGGAT59
    WDR36exon18-FGATGGCATCTATGACATAAGTC51
    WDR36exon19-RGCATTGTCAGTGCTGTCTTAC54
    WPRE-RCATAGCGTAAAAGGAGCAACA53
    16S-27FAGAGTTTGATCCTGGCTCAG54
    16S-27F(M)AGAGTTTGATCMTGGCTCAG54
    16S-534RATTACCGCGGCTGCTGG59
    18S-NS1GTAGTCATATGCTTGTCTC47
    18S-NS4CTTCCGTCAATTCCTTTAAG49
    18S-NS8TCCGCAGGTTCACCTACGGA61
    ITS1TCCGTAGGTGAACCTGCGG60
    ITS4TCCTCCGCTTATTGATATGC52
    * If your universal primer is not on this list, we would be pleased to synthesize it and add it.

Shipping’s rules

  • All samples must be shipped in 1.5 ml Eppendorf microtubes, in PCR strips tubes or in 96-well microplates.
  • Always write your order number on the top of your tubes. Your order number will be inscribed on your order confirmation page.
  • Write the names of your samples and primers legibly on the side of your tubes. If the names of your samples are long, you can identified them with the reference well ID in the submission form (ex: A1, B1, C1, etc) or numbered them (ex: 1, 2, 3, etc)
  • If Paraffin is used to close your tubes, please apply a small quantity.
  • Each tube must have a minimum of 10 µl.
  • Please do not use tape to identify your tubes. It has the unfortunate habit of falling off at -20ºC.
  • Please do not use tape to join your samples together. It then becomes difficult to separate them and it remove the ink on your tubes. Rather, use an envelope, a storage bag (ex: Ziploc®) or other easy-to-handle container.
  • It is not necessary to put your DNA on ice or dry ice if they are not contaminated by endonucleases.
  • It is recommended to protect your samples during transport: use a bubble wrap envelope or a solid container like a Falcon tube of 50 mL.

Please ensure that your samples do not arrive here on the weekends or holidays.

Adresse d’envoi

  • External clients:Patrick Laplante,
    Manager
    SANGER and SEQUENOM Sequencing Platform (CHU de Québec Research Center-CHUL)
    2705, boulevard Laurier, TR-72
    Quebec City, Quebec
    CANADA G1V 4G2
  • Internal clients:
    • Your samples can be left at the reception desk of bloc T in Room TR-72 or in the entrance of the Infectious Disease Research Center in Room RC-709
    • You can bring them to room R-4756 if you are authorized to do so.
    • You can send them to us by internal courier; however, you must allow for one extra day for delivery.